mouse fancd2  (Santa Cruz Biotechnology)

Journal: Advanced science (Weinheim, Baden-Wurttemberg, Germany)

Article Title: DNA-PKcs-Driven YAP1 Phosphorylation and Nuclear Translocation: a Key Regulator of Ferroptosis in Hyperglycemia-Induced Cardiac Dysfunction in Type 1 Diabetes.

doi: 10.1002/advs.202412698

Figure Lengend Snippet: Figure 2. DNA-PKcs regulates the DDR and contributes to hyperglycemia-induced myocardial dysfunction. In vivo, cardiomyocyte-specific DNA-PKcs knockout (DNA-PKcsCko) and wild-type DNA-PKcsf/f mice were injected intraperitoneally with streptozotocin (STZ, 50 mg kg−1 in 0.1 mol L−1 citrate buffer) for five consecutive days to induce diabetes. Age- and sex-matched non-diabetic control mice were injected with PBS. In vitro, HL-1 cardiomyocytes were cultured in high-glucose (HG, 30 mmol L−1) medium for 48 h to mimic hyperglycemic stress, while cells incubated in normal glucose (NG, 5.5 mmol L−1) medium served as controls. A) Western blot analysis of DDR markers 𝛾H2AX, MDC1, and 53BP1 in protein extracts from STZ- or PBS-treated mice. B) Western blot analysis of 𝛾H2AX, MDC1, and 53BP1 in HL-1 cells transduced with sh-scramble, sh-FANCD2, or sh-UBE2T, and exposed to HG or NG conditions. C) Immunofluorescence staining for 𝛾H2AX in HL-1 cells exposed to HG stress. D) DNA damage assessment via comet assays in HG-treated HL-1 cells; arrows indicate nuclei with DNA damage. E) Quantification of 𝛾H2AX-positive cells in response to HG stress. F) Quantification of comet assays in HL-1 cells. G–J) Western blot analysis of phosphorylated DNA-PKcs (p-DNA-PKcs), Ku80, and phosphorylated ATM (p-ATM) in protein extracts from STZ- or PBS-treated mice. K) ELISA for DNA-PKcs, Ku80, and ATM activities in diabetic and non-diabetic heart tissue. L) Immunofluorescence staining for 𝛾H2AX in HL-1 cells transduced with sh-scramble or sh-DNA-PKcs. M) Quantification of 𝛾H2AX-positive cells in response to HG stress. N) Comet assays in HL-1 cells transduced with sh-scramble or sh-DNA-PKcs; arrows indicate nuclei with DNA damage. O) Quantification of comet assays in HL-1 cells. P) MTT assay to evaluate cell viability in HL-1 cells infected with sh-DNA-PKcs. ELISA to measure lactate dehydrogenase (LDH) levels in culture media from HL-1 cells infected with sh-DNA-PKcs. Q) MTT assay to evaluate cell viability in HL-1 cells treated with the DNA-PKcs inhibitor NU7441. ELISA to measure LDH levels in culture media from HL-1 cells treated with NU7441. R) MTT assay to assess cell viability in HL-1 cells transduced with Ad-DNA-PKcs under HG conditions (30 mmol L−1). ELISA to measure LDH levels in culture media from HL-1 cells transduced with Ad-DNA-PKcs under HG conditions (30 mmol L−1). Each group consisted of 4 animals or 4 independent cell culture experiments

Article Snippet: RNA Interference and Transfection: Lentiviral-based short hairpin RNAs (shRNAs) targeting mouse FANCD2 (Santa Cruz Biotechnology, Cat. No. sc-35357), UBE2T (Santa Cruz Biotechnology, Cat. No. sc-106661), DNA-PKcs (Santa Cruz Biotechnology, Cat. No. sc-35201), or scramble shRNA targeting enhanced green fluorescent protein (GFP) (Santa Cruz Biotechnology, Cat. No. sc-45924) were used for the knockdown experiments.

Techniques: In Vivo, Knock-Out, Injection, Control, In Vitro, Cell Culture, Incubation, Western Blot, Transduction, Staining, Enzyme-linked Immunosorbent Assay, MTT Assay, Infection

Journal: BMC Cancer

Article Title: FANCD2 inhibits ferroptosis by regulating the JAK2/STAT3 pathway in osteosarcoma

doi: 10.1186/s12885-023-10626-7

Figure Lengend Snippet: Primers for qRT-PCR in this study

Article Snippet: The human osteosarcoma cell lines (MG-63 and U2OS) and osteoblast cells (hFOB1.19) were obtained from Chinese Academy of Sciences Cell Bank (Shanghai, China), and cultured in DMEM medium (Invitrogen, Carlsbad, CA, USA) containing 10% FBS, 1% streptomycin/penicillin at 37 °C in an atmosphere of 5% CO 2 . siRNA targeting FANCD2 (si-FANCD2) and si-NC were purchased from RiboBio (Shanghai, China).

Techniques: Sequencing

Journal: BMC Cancer

Article Title: FANCD2 inhibits ferroptosis by regulating the JAK2/STAT3 pathway in osteosarcoma

doi: 10.1186/s12885-023-10626-7

Figure Lengend Snippet: FANCD2 is up-regulated in osteosarcoma cells. Relative protein expression of FANCD2 in osteosarcoma cells was determined by western blot. ** P < 0.01 versus hFOB1.19

Article Snippet: The human osteosarcoma cell lines (MG-63 and U2OS) and osteoblast cells (hFOB1.19) were obtained from Chinese Academy of Sciences Cell Bank (Shanghai, China), and cultured in DMEM medium (Invitrogen, Carlsbad, CA, USA) containing 10% FBS, 1% streptomycin/penicillin at 37 °C in an atmosphere of 5% CO 2 . siRNA targeting FANCD2 (si-FANCD2) and si-NC were purchased from RiboBio (Shanghai, China).

Techniques: Expressing, Western Blot

Journal: BMC Cancer

Article Title: FANCD2 inhibits ferroptosis by regulating the JAK2/STAT3 pathway in osteosarcoma

doi: 10.1186/s12885-023-10626-7

Figure Lengend Snippet: FANCD2 silencing inhibits cell proliferation, migration, and invasion of osteosarcoma cells. (A) FANCD2 mRNA expression was detected by RT-qPCR. (B) FANCD2 protein expression was determined by western blot; the membranes were cut prior to hybridisation with antibodies. (C) Cell viability of MG-63 and U2OS cells was measured by MTT assay. (D) The proliferation of MG-63 and U2OS cells was detected by the EdU detection kit. E-F. The migration and invasion of MG-63 and U2OS cells were determined by wound healing and transwell assay. ** P < 0.01 versus si-NC

Article Snippet: The human osteosarcoma cell lines (MG-63 and U2OS) and osteoblast cells (hFOB1.19) were obtained from Chinese Academy of Sciences Cell Bank (Shanghai, China), and cultured in DMEM medium (Invitrogen, Carlsbad, CA, USA) containing 10% FBS, 1% streptomycin/penicillin at 37 °C in an atmosphere of 5% CO 2 . siRNA targeting FANCD2 (si-FANCD2) and si-NC were purchased from RiboBio (Shanghai, China).

Techniques: Migration, Expressing, Quantitative RT-PCR, Western Blot, Hybridization, MTT Assay, Transwell Assay

Journal: BMC Cancer

Article Title: FANCD2 inhibits ferroptosis by regulating the JAK2/STAT3 pathway in osteosarcoma

doi: 10.1186/s12885-023-10626-7

Figure Lengend Snippet: FANCD2 silencing predisposes ferroptosis. (A) The levels of iron, ferrous iron, and LIP were determined by iron detection kits and calcein-acetoxymethyl ester method, respectively. (B) The expression of ferroptosis-related genes (FTH1, GPX4, and COX2) was determined by RT-qPCR. (C) MDA, SOD, and CAT content were determined by the appropriate kits. ** P < 0.01 versus si-NC. ## P < 0.01 versus si-FANCD2

Article Snippet: The human osteosarcoma cell lines (MG-63 and U2OS) and osteoblast cells (hFOB1.19) were obtained from Chinese Academy of Sciences Cell Bank (Shanghai, China), and cultured in DMEM medium (Invitrogen, Carlsbad, CA, USA) containing 10% FBS, 1% streptomycin/penicillin at 37 °C in an atmosphere of 5% CO 2 . siRNA targeting FANCD2 (si-FANCD2) and si-NC were purchased from RiboBio (Shanghai, China).

Techniques: Expressing, Quantitative RT-PCR

Journal: BMC Cancer

Article Title: FANCD2 inhibits ferroptosis by regulating the JAK2/STAT3 pathway in osteosarcoma

doi: 10.1186/s12885-023-10626-7

Figure Lengend Snippet: FANCD2 interacts with the JAK2/STAT3 pathway. The expression of JAK, p-JAK, STAT3, and p-STAT3 was determined by western blot. ** P < 0.01 versus si-NC

Article Snippet: The human osteosarcoma cell lines (MG-63 and U2OS) and osteoblast cells (hFOB1.19) were obtained from Chinese Academy of Sciences Cell Bank (Shanghai, China), and cultured in DMEM medium (Invitrogen, Carlsbad, CA, USA) containing 10% FBS, 1% streptomycin/penicillin at 37 °C in an atmosphere of 5% CO 2 . siRNA targeting FANCD2 (si-FANCD2) and si-NC were purchased from RiboBio (Shanghai, China).

Techniques: Expressing, Western Blot

Journal: BMC Cancer

Article Title: FANCD2 inhibits ferroptosis by regulating the JAK2/STAT3 pathway in osteosarcoma

doi: 10.1186/s12885-023-10626-7

Figure Lengend Snippet: Colivelin attenuates the inhibition effects of FANCD2 silencing on malignant phenotype of osteosarcoma cells. (A) Cell viability of U2OS cells was determined by MTT assay. (B) The proliferation of U2OS cells was detected by the EdU detection kit. C-D. Wound healing and transwell assay were used to analyze U2OS cell migration and invasion. * P < 0.05, ** P < 0.01 versus si-NC. # P < 0.05, ## P < 0.01 versus si-FANCD2

Article Snippet: The human osteosarcoma cell lines (MG-63 and U2OS) and osteoblast cells (hFOB1.19) were obtained from Chinese Academy of Sciences Cell Bank (Shanghai, China), and cultured in DMEM medium (Invitrogen, Carlsbad, CA, USA) containing 10% FBS, 1% streptomycin/penicillin at 37 °C in an atmosphere of 5% CO 2 . siRNA targeting FANCD2 (si-FANCD2) and si-NC were purchased from RiboBio (Shanghai, China).

Techniques: Inhibition, MTT Assay, Transwell Assay, Migration

Journal: BMC Cancer

Article Title: FANCD2 inhibits ferroptosis by regulating the JAK2/STAT3 pathway in osteosarcoma

doi: 10.1186/s12885-023-10626-7

Figure Lengend Snippet: Colivelin reverses the effects of FANCD2 silencing on ferroptosis. (A) The levels of iron, Fe 2+ , and LIP were determined by iron detection kits and calcein-acetoxymethyl ester method. (B) RT-qPCR was used to detect the expression of ferroptosis-related genes. (C) The levels of MDA, SOD, and CAT were detected by the appropriate kits. ** P < 0.01 versus si-NC. # P < 0.05, ## P < 0.01 versus si-FANCD2. & P < 0.05, && P < 0.01 versus Erastin

Article Snippet: The human osteosarcoma cell lines (MG-63 and U2OS) and osteoblast cells (hFOB1.19) were obtained from Chinese Academy of Sciences Cell Bank (Shanghai, China), and cultured in DMEM medium (Invitrogen, Carlsbad, CA, USA) containing 10% FBS, 1% streptomycin/penicillin at 37 °C in an atmosphere of 5% CO 2 . siRNA targeting FANCD2 (si-FANCD2) and si-NC were purchased from RiboBio (Shanghai, China).

Techniques: Quantitative RT-PCR, Expressing

Journal: BMC Cancer

Article Title: FANCD2 inhibits ferroptosis by regulating the JAK2/STAT3 pathway in osteosarcoma

doi: 10.1186/s12885-023-10626-7

Figure Lengend Snippet: FANCD2 silencing inhibits tumor growth. (A) Tumor tissue images and tumor volume were measured in different groups. (B) Tumor weight was assessed in different groups. ** P < 0.01 versus Lv-sh-NC. (C) IHC staining of FANCD2 expression in tumor tissues of Lv-shNC and Lv-shFANCD2 groups. (D) The expression of ferroptosis-related genes in tumor tissues was detected by RT-qPCR

Article Snippet: The human osteosarcoma cell lines (MG-63 and U2OS) and osteoblast cells (hFOB1.19) were obtained from Chinese Academy of Sciences Cell Bank (Shanghai, China), and cultured in DMEM medium (Invitrogen, Carlsbad, CA, USA) containing 10% FBS, 1% streptomycin/penicillin at 37 °C in an atmosphere of 5% CO 2 . siRNA targeting FANCD2 (si-FANCD2) and si-NC were purchased from RiboBio (Shanghai, China).

Techniques: Immunohistochemistry, Expressing, Quantitative RT-PCR

Journal: Cell reports

Article Title: Cooperation of the ATM and Fanconi Anemia/BRCA Pathways in Double-Strand Break End Resection

doi: 10.1016/j.celrep.2020.01.052

Figure Lengend Snippet: (A) Immunofluorescence and quantification of the percentage of cells with BrdU-positive cells 6 h after treatment with irradiation (5 Gy) following 24 h exposure to DMSO or M3541 (1 μM) in control and FANCD2-KO U2OS cells: representative images (left panel) and graphical quantitation of BrDU-positive cells (right panel). One hundred nuclei were randomly counted. *p < 0.05, unpaired two-tailed Student’s t test. Data are shown as mean ± SD from three independent experiments.

Article Snippet: siRNA targeting sequence: FANCD2: CTGGCTCAGGATTCTAATGTA , QIAGEN , N/A.

Techniques: Immunofluorescence, Irradiation, Control, Quantitation Assay, Two Tailed Test

Journal: Cancer research

Article Title: Melphalan and exportin 1 inhibitors exert synergistic anti-tumor effects in preclinical models of human multiple myeloma

doi: 10.1158/0008-5472.CAN-19-0677

Figure Lengend Snippet: Human U266 (A), 8226 (C) and MEL-resistant U266-LR6 (B) 8226-LR5 (D) MM cells were treated for 2 hours with 50 μM MEL, washed, and placed in fresh media with or without control or SEL. Protein (100 μg) was separated by gradient acrylamide gel electrophoresis for 4 hours to separate FANCD2 from mono-ubiquitinated-FANCD2. SEL was found to decrease both ubiquitinated and total FANCD2 as shown in representative Western blots from both parental U266 (A) and 8226 (B) and MEL-resistant U266-LR6 (C) and 8226-LR5 (D) cells(n=4).

Article Snippet: Small interfering RNA (siRNA) duplexes for FANCD2 (cat#SR301519) and universal scrambled negative control duplexes (cat#SR30004/517–220063241) were obtained from OriGene (Rockville, MD).

Techniques: Control, Acrylamide Gel Assay, Electrophoresis, Western Blot

Journal: Cancer research

Article Title: Melphalan and exportin 1 inhibitors exert synergistic anti-tumor effects in preclinical models of human multiple myeloma

doi: 10.1158/0008-5472.CAN-19-0677

Figure Lengend Snippet: 8226 and 8226-LR5 human MM cells were either untreated or treated with 50 μM MEL for 2 hours. The cells were then collected by centrifugation and incubated for 24 hours with fresh media with or without 300 nM SEL. The cells were assayed for proximity co-localization of FANCD2 and ubiquitin. More than 700 cells were assayed for each experimental treatment group. The proximity ligation assay generates a red fluorescent signal when the two proteins tested (FANCD2 and ubiquitin) are within 40 nM of each other. The values on the y-axis represent the change in ubiquitin-FANCD2 nuclear foci percentages compared to untreated controls (whose values were set at 100%).

Article Snippet: Small interfering RNA (siRNA) duplexes for FANCD2 (cat#SR301519) and universal scrambled negative control duplexes (cat#SR30004/517–220063241) were obtained from OriGene (Rockville, MD).

Techniques: Centrifugation, Incubation, Ubiquitin Proteomics, Proximity Ligation Assay

Journal: Cancer research

Article Title: Melphalan and exportin 1 inhibitors exert synergistic anti-tumor effects in preclinical models of human multiple myeloma

doi: 10.1158/0008-5472.CAN-19-0677

Figure Lengend Snippet: Human MM U266 and MEL-resistant U266-LR6 cells were transfected with control (scram) siRNA and FANCD2 siRNA. After 48 hours, cells were treated with 50 μM MEL for 2 hours, washed, and then incubated for a further 48 hours. At the 24- and 48-hour time points, DNA damage was assessed by measuring γH2AX protein expression by FACS analysis. FANCD2 knockdown was > 82% (U266 cells inset).

Article Snippet: Small interfering RNA (siRNA) duplexes for FANCD2 (cat#SR301519) and universal scrambled negative control duplexes (cat#SR30004/517–220063241) were obtained from OriGene (Rockville, MD).

Techniques: Transfection, Control, Incubation, Expressing, Knockdown

Journal: Cancer research

Article Title: Melphalan and exportin 1 inhibitors exert synergistic anti-tumor effects in preclinical models of human multiple myeloma

doi: 10.1158/0008-5472.CAN-19-0677

Figure Lengend Snippet: Human U266 (A), 8226 (C) and MEL-resistant U266-LR6 (B) 8226-LR5 (D) MM cells were treated for 2 hours with 50 μM MEL, washed, and placed in fresh media with or without control or SEL. Protein (100 μg) was separated by gradient acrylamide gel electrophoresis for 4 hours to separate FANCD2 from mono-ubiquitinated-FANCD2. SEL was found to decrease both ubiquitinated and total FANCD2 as shown in representative Western blots from both parental U266 (A) and 8226 (B) and MEL-resistant U266-LR6 (C) and 8226-LR5 (D) cells(n=4).

Article Snippet: FANCD2 small interfering RNA knockdown Small interfering RNA (siRNA) duplexes for FANCD2 (cat#SR301519) and universal scrambled negative control duplexes (cat#SR30004/517–220063241) were obtained from OriGene (Rockville, MD).

Techniques: Control, Acrylamide Gel Assay, Electrophoresis, Western Blot

Journal: Cancer research

Article Title: Melphalan and exportin 1 inhibitors exert synergistic anti-tumor effects in preclinical models of human multiple myeloma

doi: 10.1158/0008-5472.CAN-19-0677

Figure Lengend Snippet: 8226 and 8226-LR5 human MM cells were either untreated or treated with 50 μM MEL for 2 hours. The cells were then collected by centrifugation and incubated for 24 hours with fresh media with or without 300 nM SEL. The cells were assayed for proximity co-localization of FANCD2 and ubiquitin. More than 700 cells were assayed for each experimental treatment group. The proximity ligation assay generates a red fluorescent signal when the two proteins tested (FANCD2 and ubiquitin) are within 40 nM of each other. The values on the y-axis represent the change in ubiquitin-FANCD2 nuclear foci percentages compared to untreated controls (whose values were set at 100%).

Article Snippet: FANCD2 small interfering RNA knockdown Small interfering RNA (siRNA) duplexes for FANCD2 (cat#SR301519) and universal scrambled negative control duplexes (cat#SR30004/517–220063241) were obtained from OriGene (Rockville, MD).

Techniques: Centrifugation, Incubation, Ubiquitin Proteomics, Proximity Ligation Assay

Journal: Cancer research

Article Title: Melphalan and exportin 1 inhibitors exert synergistic anti-tumor effects in preclinical models of human multiple myeloma

doi: 10.1158/0008-5472.CAN-19-0677

Figure Lengend Snippet: Human MM U266 and MEL-resistant U266-LR6 cells were transfected with control (scram) siRNA and FANCD2 siRNA. After 48 hours, cells were treated with 50 μM MEL for 2 hours, washed, and then incubated for a further 48 hours. At the 24- and 48-hour time points, DNA damage was assessed by measuring γH2AX protein expression by FACS analysis. FANCD2 knockdown was > 82% (U266 cells inset).

Article Snippet: FANCD2 small interfering RNA knockdown Small interfering RNA (siRNA) duplexes for FANCD2 (cat#SR301519) and universal scrambled negative control duplexes (cat#SR30004/517–220063241) were obtained from OriGene (Rockville, MD).

Techniques: Transfection, Control, Incubation, Expressing, Knockdown